Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

PKS1

Victor ID 4827
Gene Name PKS1
Sequence Strain (Species/Organism) Exophiala dermatitidis 8656
NCBI Nucleotide GI 29165632
NCBI Protein GI 29165633
Protein Accession AAD31436.3
Taxonomy ID 5970
Gene Strand (Orientation) ?
Protein Name type I polyketide synthase
DNA Sequence
>gi|29165632|gb|AF130309.3| Exophiala dermatitidis type I polyketide synthase (PKS1) gene, complete cds
TTCGTCCCAGGCCTTTTTCCAGTCAGCCCAGCATCGGTAGCNAACAACCCAATGCATCATTATCNTTTCC
AGACCCAGGGTGCGGTTGAGNTTCCTGAGATCCTTTAGCNAAAATCTTCAANTTAGNTACGAACGGCATC
ATTGCATTGACGAACAGTGTTGANGTCCGGTTAGGGCNTCGAGTTGGTTGGCTTGCGACAAGCCNACTTT
ATTGTTGGCNTGAAGGCGCAGGCGGCGGGTGCCATTATTATTATCTGACAGAGGCGGCGGTAACGGCTGT
GTAAGATTACCACCAACCNTGGCCTTAGGGCCTTGTNTCATATGGATCTGCCCTTCGCTTACTGTATTCG
GGCCCCGAAAAAAGTGCTGACCAGGGTTAGGAGAGCACCCGNTACGGCCGGTGGAGCCTTACATGACCGC
GACANTCGACCAAGCAGTCTCTCCAGATTTGGATGCTTGCCATGCTCTCTGATTTCCAACGCAGATNTCG
TGCATGCCCTTGACCCACCAGGGGGCGCTGTTATTCACGACTGGGCCATTGAATCTATTTTCACCTGGCG
TGCCTTGGGATCCGTCTCCTATATGATAGCCTACCACCCCGTCCACTCGCTCACACTCTCGTTAAGCAAC
GCTCGTTTGAAGTTCGTCGACTGATCACCAGCACCATGGAGGAGGTCTACGTCTTCGGCGACCAAACGGC
TGACTGCCGGGCGTTCTTCACCAAGGTCTTTACCCGGAAGGACAATGTCCTCTTGCAGAGCTTCCTGGAA
AGAGCTGGTGAAGCCGTCAGATTCGAAAACCAGAACCGATCACATCCCTCCAAAGCAGTCCCTAATTTCT
CTACCATCCAAGAGCTTGTCGACCGTTATTACAGAGGTGACGCGAAGGATGCCGCGACCGAGAGTGCTCT
CGTTTGCATTTCACAGTTTTGTCATTTCATTGGGTATGTTCTCTCGCCTTACCCCTGAATCTCGCTTGAC
CATGATCTGACATTCTGCGCAGTGCCTTTGAGGAGAGACGGCCTTCGTATATTCAACCTAATTCAGATGC
TCGACTAGTCGGTCTGTGCACAGGTCTAATTGCTGCGACCGCAGTCGCTGCCTCAGATTCCCTGACAGCC
CTTATTCCTTTGGCGGTCGAAGCGGTCCGGATAGCGTTCAGAGCTGGTGCCCACGTGGGAAAAGTTGCAC
AGCAGACAGAATGTGACTCCAAGACTCAATCGTGGTCCACCATCGTTGCTGCCGACGAGAAATCTGCGCA
GGAGGCTCTGGATGCCTTTCACAAAGAGAANGGTACATCACCCATCAACCAGTTGTGGATCAGTGTTTCT
TCCGCCACTTCAGTCACCATTAGCGTTCCGCCATGGACCAAAGCCCGTCTTTTNGAAGAGTCAGAGTTCT
TCCGCACACAAAAGAGTGCTCCAGTGTCAATATTCGCTCCNTATCACGCATCGCACNTACACTCGCAATC
CGATTTGGACAAAATCTTACGACCGCAGACCAAGACAATCTTTGGCAATACCACAGTGCGGTTTCCCGTC
TGCTCAAGCGTGACCGGCAAACCGTTCAACGCTGAAAATGGGTTTGAGCTTCTCCAGGCCGCGTTGAAAG
AAATCATAATCGATCCCCTGCGATGGGACAAGGTGTTGAAATATTGTGCGGCAGGGAAGGCGTCGGAAGC
CAAGGTATTCGCTGTTGGACCGACAAACCTGGCGAGCAGTGTGGTCTCCGCTCTCAAAGCCTCAACAACG
AAGGTCACGCTGGAAGACCACTCCACCTGGAGTACAGTGCCACCGCAGGGAACGCGTCATTCAAAACGAG
AGGCTGATATCGCTATTGTCGGCTTCTCTGGTCGCTTCCCCGACGCCGCAGATAATGAGCTTTTCTGGCA
ATTGTTGGAACGTGGCTTGGATGTTCACCGGCCGGTCCCTCCCGACAGGTTCCCTGTCGAGAGCCACACT
GATCCAAGTGGAAAGAAGAAGAACACCTCTCACACACCGTTTGGCAATTTTATTGAGAAGCCAGGCTTGT
TTGACGCGAGGTTCTTCAATATGTCACCAAGAGAAGCCGCACAAACTGACCCCATGCAGCGGCTGATGTT
GACCACCGGCTATGANGCTATGGAAATGGCTGGCATCGTCCCTGGCANAACACCCTCNACNAANCATGAC
AGAATTGGCACTTTCTACGGTCAAACCTCANACNATTGGCGTGAGGTCAATGCCGCCCANGATATTGATA
CATATTTCATTTCAGGTGGCGTGCGCGCCTTCGGACCTGGTCNGATCAACTACTTTTTTAAGTTTTCCGG
ACCTANTTTCTCGGTGGACACTGCNTGCTCATCCAGCTTGGCCGCNATGAATGTCGCAATCACATCTCTC
AGAGCAAATGAGTGCGATACTGTGTTCACGGGTGGTGCCAATGTGCTCACGAACTCTGACATTTTCTCTG
GTCTCAGCAGAGGCCACTTCTTGTCCAAAACCGGGTCTTGCAAGACATGGGATAATGACGCTGATGGCTA
CTGCCGCGGCGATGGTGTTTGCACGGTCATCATGAAGCGTCTTGACGATGCCCTTGCGGATCGAGACCCT
GTTCTGGGTGTTATCCGCGGTATTGGCACGAACCATTCAGCAGAAGCCGTTTCTATCACCCATCCCTGTG
CGGAGAATCAGGCATTCTTGTTCGACAAGGTGCTCAAAGAGTGCAACGTTCACTGCAATGACGTCAACTA
CGTTGAGATGCACGGCACAGGCACGCAGGCAGGCGACGGCATCGAGATGGAATCTGTCTCATCTGTTTTT
GCCCCACGACAGCCTCGAAGACGTCCTGACCAGCCTCTCTACGTTGGTGCAGTCAAGTCAAACATCGGTC
ACGGTGAGGCCGTTTCTGGCGTATCCGCTCTGATCAAGGTGCTCCTTATGCTGCAAAAGAACAAGATCCC
GCCTCATACCGGCATCAAAAAACAGATCAACAAGAACTTTGCACCAGATCTCAAGGAGCGCAACGTCAAT
ATTGCCTTCCAGACAACGCCTTTTCCACGCCCACCTGGTGGCAAGCGAACTGTGTTCATCAACAACTTTA
GTGCAGCTGGTGGTAACACAGCGATGCTTTTGCAAGATGGCCCGGAGGTCCCAACGGAGCCTTCTTCTGA
CCCAAGATCGACCCATGTGGTGACANTCTCAGCGAAATCTTTGGCCGCTTTTAAGAGGACCCTTGCCAAA
TACGAAGCNTATTTGAATGCGCACCCGAATGTCGGCCTTCCCGACCTTGCATACACTGTCACGGCCCGCC
GGGCGCATTACAGCTTACCGCGCCGCTTCCCAGTTCAGTCAATTTCTCAGTTGCAAGCTTCGTTGAGGGC
CATTCAGGACCAGACCCACAACCCGATCCCCCTTGCCTCACCTCAGATTGCTATGGCTTTTACAGGGCAA
GGTTCACAGTACACTGGGATGGGCCAGAAATTGTTTGAGACATCGAAGCAATTCCGACAAGACATCGAAG
AGTTCAATGAGATCGCTCTTCGGCAGGGGCTCCCTTCTATTATGCCCTTGATCGATGGATCTGTGGAAGT
TCAGCATCTACCGCCCACAGTCGTCCAACTCGGTATGTGCTGTATTCAAATGGCTCTTACTCATCTTTGG
TCGACTTGGGGAATTCAGCCCAGTGTTGTTATCGGTCACTCCTTGGGAGAATACGCTGCTCTCCAAGCCG
CTGGCGTTCTGTCCATTGCCGACACCATCTATCTGGTTGGTAAGCGAGCTCAGCTGCTGGAGCAGAAGTG
CACAGCAGGCACTCATGCGATGCTTGCCGTGAGATCTCCTGTTGGTGGGCTCCAGGATGTGGTTGCCAAT
AGCCATGGCAAGATTGAAAATTGCGGCATCAACGGCGTGTCTGACACTGTTCTTTCCGGCACAATGGGCG
ATATTGATACCGTCGCTCAAAAACTGGCGGACGCTGGCCAGAAGTGCACCAAGTTGAAGTTGCCATTCGC
ATTTCATTCATCCCAAGTCGATCCCATTTTGGCAGACTTCGAAAAATTGGCCTCTTCGGTCAATTACCAC
CCACCCCGTGTTCCTGTCATCTCGCCCCTGTTGAGCGATGTTGTCAGTGTCGGGGGCGTCTTCGATGCAT
TCTACCTCAGTAGACACTGCCGCAAGACAGTCGACTTTGTCGGTGGGTTGTCCGCTGGTATGTCAACCGC
CACCATTAGCGATACTTCGCTTTGGCTCGAGGTTGGCGGTCACCCCCTCTGCGCCAGCATGATCAAATCT
TGCTTGTCAGTCCCAACCCTGGCCACGATGCGCCGTGATGAAGACCCCTGGAAGATCATTTCTGCGTCCA
TGGCCGGCCTCTATACGGCCGGGAAGTCTTTGAACTGGGATGCATTCCACAAGGAGAACGAGTCCTTGCG
CGTGCTCAACGACTTGCCATTCTATGGATTCGACGAGAAGAATTACTGGTTACAGTACACTGGAGATTGG
CTTTTGTACAAGGGCGACTACCCCAAGGCGATTGCCCCAGCTCCAGCCGCCGCTGCAGCAGCAAGGCCTG
CCAAAGCGAGGAAATATCTGTCAACCTCCGTTCAAGGTATTGTCTCCGAAGAGGTCAAGGGCAAGACTGT
CACGATTGTCGCCGAGTCCGACTTTGCGCACCCGAAATTGTTCCCGGTCATTGCCGGTCACCTTGTCAAC
GGCAGTGGTCTCTGCCCGTCCACATTGTATGCCGACATGGCCTACACCCTTGGTCAACTAGGCGTTGGCC
TCCTGAAGCCGGGTGAGAAGGTGGACATCAATATTGGCACAATGGACAATCCGGCACCTCTTCTGCTCAA
GAACATCAATCAGCCTGAAAGCCAAATTGTTCAAATGACAATGAAGATCGATCTCGATGCCAGGAAAGCG
GACTTCGCTGTGACCAGCAACAATGGAAAGAAAGATGTCACTCATGCCAAGTGCGTGATCGTCTTCGAAG
ATGCTGCTGTTTGGAAAGAACAATGGAGCAAGACTTCTTACCTGATCCAGTCGAGAATCGACATGTTGAA
ACACAAGATGGAGAATGGTGAAGCCGACAAGGTTAGTCGCGCTATGGCTTACAAGCTCTTCGGCGCCCTC
GTTGACTACGCCGATATATTCCAAGGCATGCAAAACGTGGTCTTTGATGGACCGGAATTCGAGGCGACGA
GCAACATCAAATTCCGCGCTGGGCCGAACGATGGCGACTTTTACTTCAGCCCCTATTTCATTGACAGCGC
TTGCCACCTCTCANGCTTCACCGTCNATGCTACCGTCNACCCACAAGATGAGTGCTACATTTCTCATGGT
TGGTCCAGTCTCCGCTTCATTGAGCCGCTTCAGCATGACCAGCAATACTACGCATACCTCAAGATGCAGC
CCGTTTCAGGAAGCAAGATNAGAGCTGGTGATGTTTATGTCTTCAACGCGGATAAAGANGTCCTCCGTCT
TGCGGGTGGTGTGCGATTCCAGTGCATTCCCCGCAAGCTCATGGATGTGATGATGCCCAAACCTAAGGCC
AATGCAAAGGCTGCTTCCCCAGCATCTGCGACCCCGAAAGCAGCTCCAACTGTCAAAGCCTCCAGCAACC
TCGCTGCTCCTGCTTCCGTGGAACTGCCCACTCCCAAGGTCAAGGCGAAGAAGCCGGTTAAGGCACAAAA
GATCAAGGCACCAGCACCACCCAAGCAAGCCTCTTCTGGTAGTCTTGTCGTCCGGGCTTTCGAAATCATC
GCAAAGGAGATTGATGTCGACCAATCTGAACTCAATGACGATATCCAATGGGCTGACATGGGTGTTGACA
GCTTGATGTCGCTGACCATCTCTGGCAAGTTCAGGGAAGATCTTGACCTCGAGGTTGNGAGCACCCTCTT
CACCGATTACGCCTCCGTGGGCGCCCTTCGGAAGCATCTCAGCGGCATGTCTGGTCCTGAGCCCATTGCT
ACTGGTGATGCAAGCTCGGTTGAATCTACGGACTCGGGTTCGGAGAGCGACGAGGATACCGTCGAGTCGG
GCATCACCACCCCGGACACCGAAGANTTCCCAGCGAAGCNTCAGGAACAGGGGAAATCCGCTGCTGTGGA
GGCGATGGCTCAACCACCTTCCGCCGAAGGGCAGGATATGATTGAGACCATTCGNGTAGTCATCGCCCAA
GAAATGGAGATGGATCTGGCTGAAATCACGGACGNTACTGACCTCAGTAACCTCGGAATGGACTCCTTGA
TGGCCCTGACCGTTCTTGGGAAGCTTCGAGAGGATCATGACATTGATTTGGATCCGACCATCTTGGCGGA
CAATCCAACCCTGGCGCACCTCCGCAAAGCATTGGGTCTTGAGAAAGCCAAGCCGGCGCCTGCACCGAAA
CAAGANGTCAGGACCAATGTCGTTGTCGCTCCTGCTGCGCCTCCGGTTGANGTTGTCGTGCANATNCCCC
CCGCCACATCTGTGTTGCTTCAGGGCAATCCCAAGACAGCCACCAANAATCTGTTCTTGTTCCCTGATGG
CTCCGGGTCTGCCACATCCTATGTGTCTATCCCGGCCATTGACAGCAANAACCTGGCTGTCTATGGGTTA
AATTGTCCATTCATGAAAGATCCCACCAGCTATACTTGCGGGATCNAAAGTGTCTCCAANCTGTATCTTG
AAAAAGTCCTTCNCCGACAGCCTAATGGTCCATATATCCTCNGGGGCTGGTCAGCAAGTGGTGTCTTTGC
TTACNAAATCACCANACAACTCANTGACTTACAGAANCTCCACCCTGACAAGAACTACACCGTTGAAAAA
TTGAATCTTATCNACTCNCCATGCCCGATCCGTCTGGAGCCTCTACCTGCCCGCCTGCACCACTTCTTTG
ATGAAATTGGTCTTTTGGGGACAGGTACCGGCAAGACCCCGAACTGGCTGCTACCCCATTTCGAATACAG
CATCAAGGCGTTGACTGCCTACCGCCCTGAGCTGAAGTCTACACGTGATTTCAATGCACCACCCACCTTG
CTCATCTGGGCCACTGATGGTGTCTGCGGCAAGCCCGGTGACCCGAGACCGCCGCCACAAGCGGATGATC
CGAAGAGCATGAAGTGGCTGCTGGAAAACCGCACGGACTTTGGACCCAATGGATGGGACAAGCTTTTGGG
TGCTGAAGTCTGTAAAATGGTTACAGTGGTTGGTAACCATTTCACCATGATGAAACCACCGGTGGTAAGT
TAATCTCCTTCCAATTGTGTGGCAATCTTTCGAGCTAACCATTTCTTCTAGGCTAAGGGTGTTGGTCAAT
ACATCCGGGAGTCTCTCTCCATGTANAGAGCTTGACCTCGACATCTGCAACTCTTCAGACTTGTTACGTA
TAGAGATTCTCGACACAGAGGGATGGGGTTTTGATGGACATAAAATTTTGCTCATTTCACGAACGACTCT
TCGTCACTAAGTTGGAAAATTGGGGTTTGGAGCGTCAGCGGCCGCATTTTTGCTGAGCATTTNTAGAGCG
TTGGGGACTTTGTTTCTTGGTTCACTGGGCAGTGAACTTACAGACTGATTGATTGATTGCATCGGGGGGT
TTTGCATGCTTCCGCCGGACCAGCGGGTGGATAGGCGTTTGCTACTTCTTTTTGTCTCTCT

Molecule Role Virulence factor
Molecule Role Annotation MUTATION: wdpks1 mutant is less virulent in mice than the wild-type (Feng et al., 2001).
References
Feng et al., 2001: Feng B, Wang X, Hauser M, Kaufmann S, Jentsch S, Haase G, Becker JM, Szaniszlo PJ. Molecular cloning and characterization of WdPKS1, a gene involved in dihydroxynaphthalene melanin biosynthesis and virulence in Wangiella (Exophiala) dermatitidis. Infection and immunity. 2001; 69(3); 1781-1794. [PubMed: 11179356].