Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

purN

Victor ID 647
Gene Name purN
Sequence Strain (Species/Organism) Francisella tularensis
NCBI Gene ID 3191663
NCBI Protein GI 56707996
Locus Tag FTT0895
Protein Accession YP_169892.1
Other Database IDs UniProtKB-ID: Q5NGF0_FRATT
UniRef100: UniRef100_Q14HV2
UniRef90: UniRef90_A7NA94
UniRef50: UniRef50_A4IYR1
UniParc: UPI000045003D
EMBL: AJ749949
EMBL-CDS: CAG45528.1
RefSeq_NT: NC_006570.2
GenomeReviews: AJ749949_GR
HOGENOM: HBG649382
OMA: GSNMQAI
ProtClustDB: CLSK929574
Taxonomy ID 177416
Gene Starting Position 904688
Gene Ending Position 905263
Gene Strand (Orientation) +
Protein Name phosphoribosylglycinamide formyltransferase
DNA Sequence
>gi|56707187:904688-905263 Francisella tularensis subsp. tularensis Schu 4, complete genome
AATGTCTAAGCTAAATCTTGTTATATTAGGCTCTACGCGTGGGACTAATATGCAAGCTATAATAGATGCA
ATAGCAAATAAGCAGCTAAATGCTCAGATAAGCCTAGTAATTTCAAATAAGTCAGATGCTTATATATTAC
AAAGAGCAGCAGATTATAATATCCCAACTAAATATATAGCAGCTAAAGGTTTGACTAGAGAGCAGTATGA
TGAGCTAGTTGTTGCTGAAATCCAAAAATATAATCCAGATTTGATTTTGCTGATAGGCTTTATGCGTATT
TTAAGCTCGGTGTTTATCAAAGCTTTTGAAGGTAAGATCTTAAATATTCATCCATCACTATTGCCAAAGC
ACCGAGGATTAATGGATTTGGCAGTGCATCAGTCAGTTATCGACGCTGGAGATAGTATATCTGGATGCAC
TATCCATCAAGTAAGTGAAGAAGTCGATGGTGGTGATATAGTTTTGCAGTTAAAATGTGATGTGGTGAAA
GAAGATACGGCTGATAGCTTAAAAGAAAAAGTACAAGCCTTAGAGAGTAAAGCTTGGATAGAAGTTATTA
AGAATTGGGATAAGTA
Protein Sequence
>gi|56707996|ref|YP_169892.1| phosphoribosylglycinamide formyltransferase [Francisella tularensis subsp. tularensis SCHU S4] MSKLNLVILGSTRGTNMQAIIDAIANKQLNAQISLVISNKSDAYILQRAADYNIPTKYIAAKGLTREQYDELVVAEIQKYNPDLILLIGFMRILSSVFIKAFEGKILNIHPSLLPKHRGLMDLAVHQSVIDAGDSISGCTIHQVSEEVDGGDIVLQLKCDVVKEDTADSLKEKVQALESKAWIEVIKNWDK
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: purN mutant is attenuated in mouse spleen (Weiss et al., 2007).
COG COG0299F, under F: Nucleotide transport and metabolism
References
Weiss et al., 2007: Weiss DS, Brotcke A, Henry T, Margolis JJ, Chan K, Monack DM. In vivo negative selection screen identifies genes required for Francisella virulence. Proceedings of the National Academy of Sciences of the United States of America. 2007; 104(14); 6037-6042. [PubMed: 17389372].