Search: for Help
About
Introduction
Statistics
Your PHIDIAS
Register or Login
Philert
Submission
Curated Data
Victors
BBP (Brucella)
Phinfo
Phinet
HazARD
Data Analysis
Phigen
Pacodom
BLAST
Help & Documents
Documents
FAQs
Links
Acknowledgements
Disclaimer
Contact Us
UMMS Logo

FTT0798

Victor ID 670
Gene Name FTT0798
Sequence Strain (Species/Organism) Francisella tularensis
NCBI Gene ID 3191812
NCBI Protein GI 56707909
Locus Tag FTT0798
Protein Accession YP_169805.1
Other Database IDs UniProtKB-ID: Q5NGN7_FRATT
UniRef100: UniRef100_Q14I39
UniRef90: UniRef90_Q14I39
UniRef50: UniRef50_Q14I39
UniParc: UPI000049C3AA
EMBL: AJ749949
EMBL-CDS: CAG45431.1
RefSeq_NT: NC_006570.2
GenomeReviews: AJ749949_GR
HOGENOM: HBG703692
OMA: DISICTH
ProtClustDB: CLSK934684
Taxonomy ID 177416
Gene Starting Position 816641
Gene Ending Position 817648
Gene Strand (Orientation) +
Protein Name glycosyl transferase family protein
DNA Sequence
>gi|56707187:816641-817648 Francisella tularensis subsp. tularensis Schu 4, complete genome
TATGTACAATCTTAATTATAAGCAGCTAATATCTATAATCATACCAATATACAATACTCAACAATATCTT
AGTAGATGTTTAGAATCTGTTATTAATCAAACATATAAAAATTTAGAAATTATACTTATAAATGATGGGG
CAACTGATAATAGTCTATCAATTTGTCAAAAATATAAATCTAAAGATAGTCGGATCGTTTTGCTAAATCA
GCAAAACTCTGGGCAGGCATTAGCTAGAAATAATGCTTTAGATATAGCAAAAGGTGATTATATAGCATTT
ATAGATAGTGATGATTGGGTTAGTTTAGACTATATTCAAGCATTATATAATCATGTTTTTAGCTATTCAG
CAGATATCGCTATATCAGCAACGGTTGGCTGTAATAAGCAAATAAAAGCTGCTGAAATTATTCCTAGTAA
TATAAACATCTTTGATAACAATGACGCTATAATTAAGGCTTTTCTATCAAAACAGTTATCATCAATGGCA
TGCGGAAGTTTAATTAAGCGTAAACTTCTAGACAAACAACGATTTAGAAATTTTATAGCATATGAAGATT
TAGATTTTTTTTACAAAATTTACTCTCAGGCTCAAATCATAGTCAAAGACAATAATGTGCGTTATTTTTA
TTATCAGCGTGATGATGGTATTATGGGGGCTAATAGACTGAATTTCTCTTTACAGCATTTGCAAGCATTG
AAGAGTGTTACAACATATTATGAAAGATTTTTTATTGAAAAATATCCTCAGCTTGGTAGTCTAATTTATA
TGAATATTTTAAGACATCTTGTAGATAATTTTTCAGAAGCAGCGGTGCGAAAAAATGTTTTAGCTAAAGA
TGTTTTATTACTTTATAAAACTTTATACCTAAATTGTATAAGTAGGGGATTTAAGCTTAGCTTACCATAT
AAGTTATTTTTCTATTTTCCTAATCTGGTTGCAAAATGTTATTTGAAAGCGAAAAAGATTAAACTCTCAC
TCAAAGAAAAAAGAATTACTAAAAGTTA
Protein Sequence
>gi|56707909|ref|YP_169805.1| glycosyl transferase family protein [Francisella tularensis subsp. tularensis SCHU S4] MYNLNYKQLISIIIPIYNTQQYLSRCLESVINQTYKNLEIILINDGATDNSLSICQKYKSKDSRIVLLNQQNSGQALARNNALDIAKGDYIAFIDSDDWVSLDYIQALYNHVFSYSADIAISATVGCNKQIKAAEIIPSNINIFDNNDAIIKAFLSKQLSSMACGSLIKRKLLDKQRFRNFIAYEDLDFFYKIYSQAQIIVKDNNVRYFYYQRDDGIMGANRLNFSLQHLQALKSVTTYYERFFIEKYPQLGSLIYMNILRHLVDNFSEAAVRKNVLAKDVLLLYKTLYLNCISRGFKLSLPYKLFFYFPNLVAKCYLKAKKIKLSLKEKRITKS
Molecule Role Virulence factor
Molecule Role Annotation MUTATION: FTT0798 mutant is attenuated in mice (Weiss et al., 2007).
COG COG0463M, under M: Cell wall/membrane/envelope biogenesis
References
Weiss et al., 2007: Weiss DS, Brotcke A, Henry T, Margolis JJ, Chan K, Monack DM. In vivo negative selection screen identifies genes required for Francisella virulence. Proceedings of the National Academy of Sciences of the United States of America. 2007; 104(14); 6037-6042. [PubMed: 17389372].